Bio::SeqFeature::Primer - Primer Generic SeqFeature


BioPerl documentation Contained in the BioPerl distribution.

Index


Code Index:

NAME

Top

Bio::SeqFeature::Primer - Primer Generic SeqFeature

SYNOPSIS

Top

 # set up a single primer that can be used in a PCR reaction

 use Bio::SeqFeature::Primer;

 # initiate a primer with raw sequence
 my $primer=Bio::SeqFeature::Primer->new(-seq=>'CTTTTCATTCTGACTGCAACG');

 # get the primery tag for the primer # should return Primer
 my $tag=$primer->primary_tag;

 # get or set the location that the primer binds to the target at
 $primer->location(500);
 my $location=$primer->location(500);

 # get or set the 5' end of the primer homology, as the primer doesn't 
 # have to be the same as the target sequence
 $primer->start(2);
 my $start=$primer->start;

 # get or set the 3' end of the primer homology
 $primer->end(19);
 my $end = $primer->end;

 # get or set the strand of the primer. Strand should be 1, 0, or -1
 $primer->strand(-1);
 my $strand=$primer->strand;

 # get or set the id of the primer
 $primer->display_id('test_id');
 my $id=$primer->display_id;

 # get the tm of the primer. This is calculated for you by the software.
 # however, see the docs.
 my $tm = $primer->Tm;

 print "These are the details of the primer:\n\tTag:\t\t$tag\n\tLocation\t$location\n\tStart:\t\t$start\n";
 print "\tEnd:\t\t$end\n\tStrand:\t\t$strand\n\tID:\t\t$id\n\tTm:\t\t$tm\n";







DESCRIPTION

Top

Handle primer sequences. This will allow you to generate a primer object required for a Bio::Seq::PrimedSeq object. This module is designed to integrate with Bio::Tools::Primer3 and Bio::Seq::PrimedSeq.

In addition, you can calculate the melting temperature of the primer.

This module is supposed to implement location and range, presumably through generic.pm, but does not do so yet. However, it does allow you to set primers, and use those objects as the basis for Bio::Seq::PrimedSeq objects.

See also the POD for Bio::Seq::PrimedSeq and Bio::Tools::Nucleotide::Analysis::Primer3

FEEDBACK

Top

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

  https://redmine.open-bio.org/projects/bioperl/

AUTHOR

Top

Rob Edwards, redwards@utmem.edu

The original concept and much of the code was written by Chad Matsalla, bioinformatics1@dieselwurks.com

APPENDIX

Top

	The rest of the documentation details each of the object
	methods. Internal methods are usually preceded with a _

new()

 Title   : new()
 Usage   : $primer = Bio::SeqFeature::Primer(-seq=>sequence_object);
 Function: Instantiate a new object
 Returns : A SeqPrimer object
 Args    : You must pass either a sequence object (preferable) or a sequence. 

seq()

 Title   : seq()
 Usage   : $seq = $primer->seq();
 Function: Return the sequence associated with this Primer. 
 Returns : A Bio::Seq object
 Args    : None.

source_tag()

 Title   : source_tag()
 Usage   : $tag = $feature->source_tag();
 Function: Returns the source of this tag.
 Returns : A string.
 Args    : If an argument is provided, the source of this SeqFeature
           is set to that argument.

location()

 Title   : location()
 Usage   : $tag = $primer->location();
 Function: Gets or sets the location of the primer on the sequence  
 Returns : If the location is set, returns that, if not returns 0. 
           Note: At the moment I am using the primer3 notation of location
	   (although you can set whatever you want). 
	   In this form, both primers are given from their 5' ends and a length.
	   In this case, the left primer is given from the leftmost end, but
	   the right primer is given from the rightmost end.
	   You can use start() and end() to get the leftmost and rightmost base
	   of each sequence.
 Args    : If supplied will set a location

start()

 Title   : start()
 Usage   : $start_position = $primer->start($new_position);
 Function: Return the start position of this Primer.
           This is the leftmost base, regardless of whether it is a left or right primer.
 Returns : The start position of this primer or 0 if not set.
 Args    : If supplied will set a start position.

end()

 Title   : end()
 Usage   : $end_position = $primer->end($new_position);
 Function: Return the end position of this primer.
           This is the rightmost base, regardless of whether it is a left or right primer.
 Returns : The end position of this primer.
 Args    : If supplied will set an end position.

strand()

 Title   : strand()
 Usage   : $strand=$primer->strand()
 Function: Get or set the strand.
 Returns : The strand that the primer binds to.
 Args    :  If an argument is supplied will set the strand, otherwise will return it. Should be 1, 0 (not set), or -1

display_id()

 Title   : display_id()
 Usage   : $id = $primer->display_id($new_id)
 Function: Returns the display ID for this Primer feature
 Returns : A scalar.
 Args    : If an argument is provided, the display_id of this primer is
           set to that value.

Tm()

  Title   : Tm()
  Usage   : $tm = $primer->Tm(-salt=>'0.05', -oligo=>'0.0000001')
  Function: Calculates and returns the Tm (melting temperature) of the primer
  Returns : A scalar containing the Tm.
  Args    : -salt  : set the Na+ concentration on which to base the calculation
                     (default=0.05 molar).
          : -oligo : set the oligo concentration on which to base the
                     calculation (default=0.00000025 molar).
  Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997
            36:10581-10594. Also see documentation at
            http://www.idtdna.com/Scitools/Scitools.aspx as they use this
            formula and have a couple nice help pages. These Tm values will be
            about are about 0.5-3 degrees off from those of the idtdna web tool.
            I don't know why.

            This was suggested by Barry Moore (thanks!). See the discussion on
            the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
            the PrimerTM"

Tm_estimate

 Title   : Tm_estimate
 Usage   : $tm = $primer->Tm_estimate(-salt=>'0.05')
 Function: Calculates and returns the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt set the Na+ concentration on which to base the calculation.
 Notes   : This is an estimate of the Tm that is kept in for comparative reasons.
           You should probably use Tm instead!

	   This Tm calculations are taken from the Primer3 docs: They are
	   based on Bolton and McCarthy, PNAS 84:1390 (1962) 
	   as presented in Sambrook, Fritsch and Maniatis,
	   Molecular Cloning, p 11.46 (1989, CSHL Press).

	   Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length

	   where [Na+] is the molar sodium concentration, %GC is the
	   %G+C of the sequence, and length is the length of the sequence.

	   However.... I can never get this calculation to give me the same result
	   as primer3 does. Don't ask why, I never figured it out. But I did 
	   want to include a Tm calculation here because I use these modules for 
	   other things besides reading primer3 output.

	   The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
	   and this calculation is saved as $primer->Tm so you can get both and
	   average them!


BioPerl documentation Contained in the BioPerl distribution.
#
# BioPerl module for Bio::SeqFeature::Primer
#
# This is the original copyright statement. I have relied on Chad's module
# extensively for this module.
#
# Copyright (c) 1997-2001 bioperl, Chad Matsalla. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself. 
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
#
# But I have modified lots of it, so I guess I should add:
#
# Copyright (c) 2003 bioperl, Rob Edwards. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself. 
#
# Copyright Rob Edwards
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code


# Let the code begin...


package Bio::SeqFeature::Primer;
use strict;

use Bio::Seq;
use Bio::Tools::SeqStats;


use vars qw ($AUTOLOAD @RES %OK_FIELD $ID);

BEGIN {
 @RES=qw(); # nothing here yet, not sure what we want!

 foreach my $attr (@RES) {$OK_FIELD{$attr}++}
}

use base qw(Bio::Root::Root Bio::SeqFeature::Generic);

$ID = 'Bio::SeqFeature::Primer';

sub AUTOLOAD {
 my $self = shift;
 my $attr = $AUTOLOAD;
 $attr =~ s/.*:://;
 $self->throw("Unallowed parameter: $attr !") unless $OK_FIELD{$attr};
 $self->{$attr} = shift if @_;
 return $self->{$attr};
}


sub new {
  # I have changed some of Chad's code. I hope he doesn't mind. Mine is more stupid than his, but my simple mind gets it.
  # I also removed from of the generic.pm things, but we can put them back....

  my ($class, %args) = @_;  
  my $self = $class->SUPER::new(%args);
  # i am going to keep an array of the things that have been passed
  # into the object on construction. this will aid retrieval of these
  # things later
  foreach my $argument (keys %args) {
   if ($argument eq "-SEQUENCE" || $argument eq "-sequence" || $argument eq "-seq") {
    if (ref($args{$argument}) eq "Bio::Seq") {$self->{seq} = $args{$argument}}
    else {
     unless ($args{-id}) {$args{-id}="SeqFeature Primer object"}
     $self->{seq} = Bio::Seq->new( -seq => $args{$argument}, -id => $args{-id});
    }
    $self->{$argument} = $self->{seq};
    push (@{$self->{arguments}}, "seq");
   }
   else {
    $self->{$argument} = $args{$argument};
    push (@{$self->{arguments}}, $argument); # note need to check the BioPerl way of doing this.
   }
  }

  # now error check and make sure that we at least got a sequence
  if (!$self->{seq}) {$self->throw("You must pass in a sequence to construct this object.")}

   # a bunch of things now need to be set for this SeqFeature
   # things like:
   # TARGET=513,26
   # PRIMER_FIRST_BASE_INDEX=1
   # PRIMER_LEFT=484,20

   # these can be added in, and we won't demand them, but provide a mechanism to check that they exist

   $self->Tm();
   return $self;
}


sub seq {
     my $self = shift;
     return $self->{seq};
}

sub primary_tag {
     return "Primer";
}

sub source_tag {
     my ($self,$insource) = @_;
     if ($insource) { $self->{source} = $insource; }
     return $self->{source};
}

sub location {
     my ($self, $location) = @_;
     if ($location) {$self->{location}=$location}
     if ($self->{location}) {return $self->{location}}
     else {return 0}
}

sub start {
     my ($self,$start) = @_;
     if ($start) {$self->{start_position} = $start}
     if ($self->{start_position}) {return $self->{start_position}}
     else {return 0}
}

sub end {
     my ($self,$end) = @_;
     if ($end) {$self->{end_position} = $end}
     if ($self->{end_position}) {return $self->{end_position}}
     else {return 0}
}

sub strand {
     my ($self, $strand) = @_;
     if ($strand) {
      unless ($strand == -1 || $strand == 0 ||$strand == 1) {$self->throw("Strand must be either 1, 0, or -1 not $strand")}
      $self->{strand}=$strand;
     }
     if ($self->{strand}) {return $self->{strand}}
     else {return 0}
}

sub display_id {
     my ($self,$newid) = @_;
     if ($newid) {$self->seq()->display_id($newid)}
     return $self->seq()->display_id();
}


sub Tm  {
     my ($self, %args) = @_;
     my $salt_conc = 0.05; #salt concentration (molar units)
     my $oligo_conc = 0.00000025; #oligo concentration (molar units)
     if ($args{'-salt'}) {$salt_conc = $args{'-salt'}} #accept object defined salt concentration
     if ($args{'-oligo'}) {$oligo_conc = $args{'-oligo'}} #accept object defined oligo concentration
     my $seqobj = $self->seq();
     my $length = $seqobj->length();
     my $sequence = uc $seqobj->seq();
     my @dinucleotides;
     my $enthalpy;
     my $entropy;
     #Break sequence string into an array of all possible dinucleotides
     while ($sequence =~ /(.)(?=(.))/g) {
         push @dinucleotides, $1.$2;
     }
     #Build a hash with the thermodynamic values
     my %thermo_values = ('AA' => {'enthalpy' => -7.9,
                                   'entropy'  => -22.2},
                          'AC' => {'enthalpy' => -8.4,
                                   'entropy'  => -22.4},
                          'AG' => {'enthalpy' => -7.8,
                                   'entropy'  => -21},
                          'AT' => {'enthalpy' => -7.2,
                                   'entropy'  => -20.4},
                          'CA' => {'enthalpy' => -8.5,
                                   'entropy'  => -22.7},
                          'CC' => {'enthalpy' => -8,
                                   'entropy'  => -19.9},
                          'CG' => {'enthalpy' => -10.6,
                                   'entropy'  => -27.2},
                          'CT' => {'enthalpy' => -7.8,
                                   'entropy'  => -21},
                          'GA' => {'enthalpy' => -8.2,
                                   'entropy'  => -22.2},
                          'GC' => {'enthalpy' => -9.8,
                                   'entropy'  => -24.4},
                          'GG' => {'enthalpy' => -8,
                                   'entropy'  => -19.9},
                          'GT' => {'enthalpy' => -8.4,
                                   'entropy'  => -22.4},
                          'TA' => {'enthalpy' => -7.2,
                                   'entropy'  => -21.3},
                          'TC' => {'enthalpy' => -8.2,
                                   'entropy'  => -22.2},
                          'TG' => {'enthalpy' => -8.5,
                                   'entropy'  => -22.7},
                          'TT' => {'enthalpy' => -7.9,
                                   'entropy'  => -22.2},
                          'A' =>  {'enthalpy' => 2.3,
                                   'entropy'  => 4.1},
                          'C' =>  {'enthalpy' => 0.1,
                                   'entropy'  => -2.8},
                          'G' =>  {'enthalpy' => 0.1,
                                   'entropy'  => -2.8},
                          'T' =>  {'enthalpy' => 2.3,
                                   'entropy'  => 4.1}
                         );
     #Loop through dinucleotides and calculate cumulative enthalpy and entropy values
     for (@dinucleotides) {
        $enthalpy += $thermo_values{$_}{enthalpy};
        $entropy += $thermo_values{$_}{entropy};
     }
     #Account for initiation parameters
     $enthalpy += $thermo_values{substr($sequence, 0, 1)}{enthalpy};
     $entropy += $thermo_values{substr($sequence, 0, 1)}{entropy};
     $enthalpy += $thermo_values{substr($sequence, -1, 1)}{enthalpy};
     $entropy += $thermo_values{substr($sequence, -1, 1)}{entropy};
     #Symmetry correction
     $entropy -= 1.4;
     my $r = 1.987; #molar gas constant
     my $tm = ($enthalpy * 1000 / ($entropy + ($r * log($oligo_conc))) - 273.15 + (12* (log($salt_conc)/log(10))));
     $self->{'Tm'}=$tm;
     return $tm;
 }

sub Tm_estimate {

 # note I really think that this should be put into seqstats as it is more generic, but what the heck.

 my ($self, %args) = @_;
 my $salt=0.2;
 if ($args{'-salt'}) {$salt=$args{'-salt'}}
 my $seqobj=$self->seq();
 my $length=$seqobj->length();
 my $seqdata = Bio::Tools::SeqStats->count_monomers($seqobj);
 my $gc=$$seqdata{'G'} + $$seqdata{'C'};
 my $percent_gc=($gc/$length)*100;


 my $tm= 81.5+(16.6*(log($salt)/log(10)))+(0.41*$percent_gc) - (600/$length);

 # and now error check compared to primer3
 # note that this NEVER gives me the same values, so I am ignoring it
 # you can get these out separately anyway

# if ($self->{'PRIMER_LEFT_TM'}) {
#  unless ($self->{'PRIMER_LEFT_TM'} == $tm) {
#   $self->warn("Calculated $tm for Left primer but received ".$self->{'PRIMER_LEFT_TM'}." from primer3\n");
#  }
# }
# elsif ($self->{'PRIMER_RIGHT_TM'}) {
#  unless ($self->{'PRIMER_RIGHT_TM'} == $tm) {
#    $self->warn("Calculated $tm for Right primer but received ".$self->{'PRIMER_RIGHT_TM'}." from primer3\n");
#  }
# }

 $self->{'Tm'}=$tm;
 return $tm; 
} 

1;