Bio::Tools::Analysis::DNA::ESEfinder - a wrapper around ESEfinder

  use Bio::Tools::Analysis::DNA::ESEfinder;
  use strict;

  my $seq; # a Bio::PrimarySeqI or Bio::SeqI object

  $seq = Bio::Seq->new(
       -primary_id => 'test',
       -seq=>'atgcatgctaggtgtgtgttttgtgggttgtactagctagtgat'.
       -alphabet=>'dna');

  my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder->
      new(-seq => $seq);

  # run ESEfinder prediction on a DNA sequence
  $ese_finder->run();

  die "Could not get a result"
      unless $ese_finder->status =~ /^COMPLETED/;

  print $ese_finder->result;      # print raw prediction to STDOUT

  foreach my $feat ( $ese_finder->result('Bio::SeqFeatureI') ) {

      # do something to SeqFeature
      # e.g. print as GFF
      print $feat->gff_string, "\n";
      # or store within the sequence - if it is a Bio::SeqI
      $seq->add_SeqFeature($feat)

  }

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

  https://redmine.open-bio.org/projects/bioperl/

#
# BioPerl module for Bio::Tools::Analysis::DNA::ESEfinder
#
# Please direct questions and support issues to <bioperl-l@bioperl.org> 
#
# Cared for by Heikki Lehvaslaiho <heikki-at-bioperl-dot-org>
#
# Copyright Richard Adams
#
# You may distribute this module under the same terms as perl itself

# POD documentation - main docs before the code

# Let the code begin...
#should have own 

package Bio::Tools::Analysis::DNA::ESEfinder;

use Data::Dumper;
use IO::String;
use Bio::SeqIO;
use HTTP::Request::Common qw (POST);
use HTML::HeadParser;
use Bio::SeqFeature::Generic;
use Bio::Seq::Meta::Array;
use Bio::WebAgent;
use strict;

#inherits directly from SimpleAnalysisBase
use base qw(Bio::Tools::Analysis::SimpleAnalysisBase);


#global vars are now file-scoped lexicals

my $URL = 'http://rulai.cshl.org/cgi-bin/tools/ESE/esefinder.cgi';
	
my $ANALYSIS_NAME = 'ESEfinder';


my $ANALYSIS_SPEC =
    {
     'name' => 'ESEfinder',
     'type' => 'DNA', #compulsory entry as is used for seq checking
     'version' => '2.0',
     'supplier' => 'Krainer lab, Cold Spring Harbor Laboratory, POBOX100, Bungtown Rd, COld Spring Harbor, NY, USA',
     'description' => 'to identify exonic splicing elements in human transcripts',
    };

my $INPUT_SPEC =
    [{
      'mandatory' => 'true',
      'type' => 'Bio::PrimarySeqI',
      'name' => 'sequence',
     }];

my $RESULT_SPEC =
    {
     '' => 'bulk',  # same as undef
     'Bio::SeqFeatureI' => 'ARRAY of Bio::SeqFeature::Generic',
     'raw' => 'Array of [ SR_protein, position, motif, score]',
     'all' => 'Bio::Seq::Meta::Array object'
    };


### unique to this module ##
sub _init {
    ## fills in fixed data for class ##
    my $self = shift;
    $self->url($URL);
    $self->{'_ANALYSIS_SPEC'} =$ANALYSIS_SPEC;
    $self->{'_INPUT_SPEC'} =$INPUT_SPEC;
    $self->{'_RESULT_SPEC'} =$RESULT_SPEC;
    $self->{'_ANALYSIS_NAME'} =$ANALYSIS_NAME;
    return $self;
}


sub _run {
    my $self  = shift;
    my $seq_fasta;
    my $stringfh = new IO::String($seq_fasta);
    my $seqout = Bio::SeqIO->new(-fh => $stringfh,
                                -format => 'fasta');
    $seqout->write_seq($self->seq);
    $self->debug($seq_fasta);
    $self->delay(1);
    # delay repeated calls by default by 3 sec, set delay() to change
    $self->sleep;
    $self->status('TERMINATED_BY_ERROR');

    my $request = POST $self->url,
        #Content_Type => 'x-www-form-urlencoded',
            Content  => [
                         protein1 => 1,
                         protein2 => 1,
                         protein3 => 1,
                         protein4 => 1,
                         radio_sf2 => 0,
                         radio_sc35 => 0,
                         radio_srp40 => 0,
                         radio_srp55 => 0,
                         sequence =>$seq_fasta,
                        ];
    my $content = $self->request($request);
    if( $content->is_error  ) {
	$self->throw(ref($self)." Request Error:\n".$content->as_string);
    }

    my $text = $content->content; #1st reponse
    my ($tmpfile) = $text =~ /value="(tmp\/.+txt)"/;
    # now get data for all residues #
    my $rq2 = POST 'http://rulai.cshl.org/cgi-bin/tools/ESE/resultfile.txt',
        #Content_Type => 'x-www-form-urlencoded',
            Content => [
                        fname => $tmpfile,
                       ];
    my $ua2 = Bio::WebAgent->new();
    my $content2 = $ua2->request($rq2);
    if( $content2->is_error  ) {
	$self->throw(ref($self)." Request Error:\n".$content2->as_string);
    }

    my $text2 = $content2->content;
    $self->{'_result'} = $text2;		
    $self->status('COMPLETED') if $text2 ne '';

    #print Dumper $response;
}


sub result {

    #make sec feat of above threshold scores #

    my ($self,$value) = @_;

    my @sig_pdctns;
    my @fts;

    if ($value ) {
	my $result = IO::String->new($self->{'_result'});
        my $current_SR;
        my $all_st_flag = 0;
        my %all;
        while (my $line = <$result>) {
            #make array of all scores or threshold depending on $value
            last if $line =~ /^All scores/ && $value ne 'all' or $line =~ /2001,/;
            $all_st_flag++ if $line =~ /All scores/;
            next if $value eq 'all' && $all_st_flag == 0;

            #parse line
            if ($line =~ /^Protein/) {
                ($current_SR) = $line =~/:\s+(\S+)/;
                $current_SR =~ s{/}{_}; # remove unallowed charcters from hash
            }
            if ( $line =~/^\d+/ && $value ne 'all') {
                push @sig_pdctns, [$current_SR, split /\s+/, $line] ;
            } elsif ($line =~ /^\d+/) {

                push @{$all{$current_SR}}, [split /\s+/, $line];
            }
        }

        if ($value eq 'Bio::SeqFeatureI') {
            foreach (@sig_pdctns) {
                #make new ese object for each row of results
                push @fts, Bio::SeqFeature::Generic->new
                    (
                     -start => $_->[1],
                     -end => $_->[1] + length($_->[2]) -1,
                     -source => 'ESEfinder',
                     -primary => 'ESE',
                     -tag =>{
                             score =>$_->[3],
                             motif=> $_->[2],
                             SR_protein=> $_->[0],
                             method=> 'ESEfinder',
                            },
                    );
            }
            return @fts;
        }
        ## convert parsed data into a meta array format
        elsif ($value eq 'all') {
            bless ($self->seq, "Bio::Seq::Meta::Array");
            $self->seq->isa("Bio::Seq::MetaI")
                || $self->throw("$self is not a Bio::Seq::MetaI");

            for my $prot (keys %all) {
                my @meta;
                my $len =  scalar @{$all{$prot}} ;
                for (my $i = 0; $i < $len; $i++ ) {
                    $meta[$i] = $all{$prot}[$i][2];
                }

                # assign default name here so that the
                # Bio::Seq::Meta::Array can work for all classes
                # implementing it and we can avoid having to make
                # asubclass for each implementation

                $Bio::Seq::Meta::Array::DEFAULT_NAME = "ESEfinder_SRp55";
                my $meta_name = $self->analysis_spec->{'name'} . "_" . "$prot";
                $self->seq->named_meta($meta_name,\@meta );
            }
            # return  seq array object implementing meta sequence #
            return $self->seq;

        }
		#return ref to array of arrays
        return \@sig_pdctns;
    }
    return $self->{'_result'};
}


1;