| GBrowse documentation | Contained in the GBrowse distribution. |
Bio::Graphics::Browser2::Realign - Perl extension for Smith-Waterman alignments
use Bio::Graphics::Browser2::Realign 'align';
my ($top,$middle,$bottom) = align('gattttttc','gattttccc');
print join "\n",$top,$middle,$bottom,"\n";
# produces:
gatttttt--c
|||||| |
gatttt--ccc
This is a helper utility used by gbrowse to produce global alignments. It uses slow Smith-Waterman, so is only appropriate for short segments that are mostly aligned already.
It can be speeded up significantly by compiling Bio::Graphics::Browser2::CAlign, an XS extension. To do this, build gbrowse with the DO_XS=1 option:
cd Generic-Genome-Browser perl Makefile.PL DO_XS=1
The new() method takes two the two sequence strings to be aligned and an optional weight matrix. Legal weight matrix keys and their default values are shown here:
Key name Default Description -------- ------- ----------- match 1 Award one point for an exact match. mismatch -1 Penalize one point for a mismatch. wildcard_match 0 No penalty for a match to a wildcard (e.g. "n"). gap -1 Penalize one point to create a gap. gap_extend 0 No penalty for extending an existing gap. wildcard 'N' The wildcard character.
The alignment algorithm is run when new() is called.
Return the score from the alignment.
Return the start of the aligned region, in source sequence coordinates.
Return the end of the aligned region, in source sequence coordinates.
Return an arrayref representing the alignment. The array will be exactly as long as the source sequence. Its indexes correspond to positions on the source sequence, and its values correspond to positions on the target sequence. An unaligned base is indicated as undef. Indexes are zero-based.
For example, this alignment:
gatttttt--c |||||| | gatttt--ccc
corresponds to this arrayref:
index value 0[g] 0[g] 1[a] 1[a] 2[t] 2[t] 3[t] 3[t] 4[t] 4[t] 5[t] 5[t] 6[t] undef 7[t] undef 8[c] 8[c]
Returns the alignment as three padded strings indicating the top, middle and bottom lines of a pretty-printed representation.
For example:
print join "\n",$aligner->pads;
Will produce this output:
gatttttt--c |||||| | gatttt--ccc
No functions are exported by default, but the following two methods can be imported explicitly.
Align the source and target sequences and return the padded strings representing the alignment. It is exactly equivalent to calling:
Bio::Graphics::Browser2::Realign->new($source,$target)->pads;
The align_segs() function aligns $source and $target and returns an array of non-gapped segments. Each element of the array corresponds to a contiguous nongapped alignment in the format [src_start,src_end,tgt_start,tgt_end].
This is useful for converting a gapped alignment into a series of nongapped alignments.
In a list context this function will return a list of non-gapped segments.
This class method takes two padded sequence strings and the alignment string that relates them and returns an array ref of non-gapped aligned sequence in the format:
[src_start,src_end,tgt_start,tgt_end]
The 3 strings look like this CA-ACCCCCTTGCAACAACCTTGAGAACCCCAGGGA | ||||||||||||||||||||||||||||||||| AAGACCCCCTTGCAACAACCTTGAGAACCCCAGGGA
Lincoln Stein <lstein@cshl.org>.
Copyright (c) 2003 Cold Spring Harbor Laboratory
This library is free software; you can redistribute it and/or modify it under the same terms as Perl itself. See DISCLAIMER.txt for disclaimers of warranty.
Bio::Graphics::Browser.
| GBrowse documentation | Contained in the GBrowse distribution. |
package Bio::Graphics::Browser2::Realign;
# file: Sequence/Alignment.pm use strict; use Carp; use vars '@DEFAULTS'; use constant DEBUG=>0; use vars qw(@ISA @EXPORT @EXPORT_OK); require Exporter; @ISA = 'Exporter'; @EXPORT = (); @EXPORT_OK = qw(align align_segs); # The default scoring matrix introduces a penalty of -2 for opening # a gap in the sequence, but no penalty for extending an already opened # gap. A nucleotide mismatch has a penalty of -1, and a match has a # positive score of +1. An ambiguous nucleotide ("N") can match # anything with no penalty. use constant DEFAULT_MATRIX => { 'wildcard_match' => 0, 'match' => 1, 'mismatch' => -1, 'gap' => -2, 'gap_extend' => 0, 'wildcard' => 'N', }; use constant SCORE => 0; use constant EVENT => 1; use constant EXTEND => 0; use constant GAP_SRC => 1; use constant GAP_TGT => 2; my @EVENTS = qw(extend gap_src gap_tgt);
# Construct a new alignment object. May be time consuming. sub new { my ($class,$src,$tgt,$matrix) = @_; croak 'Usage: Realign->new($src,$tgt [,\%matrix])' unless $src && $tgt; my $self = bless { src => $src, target => $tgt, matrix => $matrix || {}, },$class; my $implementor = $class; if (eval {require Bio::Graphics::Browser2::CAlign}) { $implementor = 'Bio::Graphics::Browser2::CAlign'; } my ($score,$alignment) = $implementor->_do_alignment($src,$tgt,$self->{matrix}); $self->{score} = $score; $self->{alignment} = $alignment; return $self; }
# return the score of the aligned region sub score { return shift()->{'score'}; }
# return the start of the aligned region sub start { return shift()->{'alignment'}->[0]; }
# return the end of the aligned region sub end { my $alignment = shift()->{'alignment'}; return $alignment->[$#$alignment]; }
# return the alignment as an array sub alignment { shift()->{'alignment'}; }
# return the alignment as three padded strings for pretty-printing, etc. sub pads { my ($align,$src,$tgt) = @{shift()}{'alignment','src','target'}; my ($ps,$pt,$last); $ps = '-' x ($align->[0]) if defined $align->[0]; # pad up the source $pt = substr($tgt,0,$align->[0]) if defined $align->[0]; $last = $align->[0] || 0; for (my $i=0;$i<@$align;$i++) { my $t = $align->[$i]; if (defined $t) { $pt .= $t-$last > 1 ? substr($tgt,$last+1,$t-$last): substr($tgt,$t,1); $ps .= '-' x ($t-$last-1); $last = $t; } else { $pt .= '-'; } $ps .= substr($src,$i,1); } # clean up the ends $ps .= substr($src,@$align); $pt .= substr($tgt,$last+1); $pt .= '-' x (length($ps) - length($pt)) if length($ps) > length($pt); $ps .= '-' x (length($pt) - length($ps)) unless length($ps) > length($pt); my $match = join('', map { uc substr($ps,$_,1) eq uc substr($pt,$_,1) ? '|' : ' ' } (0..length($pt)-1)); return ($ps,$match,$pt); }
# take two sequences as strings, align them and return # a three element array consisting of gapped seq1, match string, and # gapped seq2. sub align { my ($seq1,$seq2,$matrix) = @_; my $align = __PACKAGE__->new($seq1,$seq2,$matrix); return $align->pads; }
sub align_segs { my ($gap1,$align,$gap2) = align(@_); return __PACKAGE__->pads_to_segments($gap1,$align,$gap2); }
sub pads_to_segments { my $self = shift; my ($gap1,$align,$gap2) = @_; # create arrays that map residue positions to gap positions my @maps; for my $seq ($gap1,$gap2) { my @seq = split '',$seq; my @map; my $residue = 0; for (my $i=0;$i<@seq;$i++) { $map[$i] = $residue; $residue++ if $seq[$i] ne '-'; } push @maps,\@map; } my @result; while ($align =~ /(\S+)/g) { my $align_end = pos($align) - 1; my $align_start = $align_end - length($1) + 1; push @result,[@{$maps[0]}[$align_start,$align_end], @{$maps[1]}[$align_start,$align_end]]; } return wantarray ? @result : \@result; } sub _do_alignment { my $class = shift; local $^W = 0; my($src,$tgt,$custom_matrix) = @_; my @alignment; $custom_matrix ||= {}; my %matrix = (%{DEFAULT_MATRIX()},%$custom_matrix); my ($max_score,$max_row,$max_col); my $scores = [([0,EXTEND])x(length($tgt)+1)]; print join(' ',map {sprintf("%-4s",$_)} (' ',split('',$tgt))),"\n" if DEBUG; my $wildcard = $matrix{wildcard}; for (my $row=0;$row<length($src);$row++) { my $s = uc substr($src,$row,1); my @row = ([0,EXTEND]); for (my $col=0;$col<length($tgt);$col++) { my $t = uc substr($tgt,$col,1); # what happens if we extend the both strands one character? my $extend = $scores->[$col][SCORE]; $extend += ($t eq $wildcard || $s eq $wildcard) ? $matrix{wildcard_match} : ($t eq $s) ? $matrix{match} : $matrix{mismatch}; # what happens if we extend the src strand one character, gapping the tgt? my $gap_tgt = $row[$#row][SCORE] + (($row[$#row][EVENT]==GAP_TGT) ? $matrix{gap_extend} : $matrix{gap}); # what happens if we extend the tgt strand one character, gapping the src? my $gap_src = $scores->[$col+1][SCORE] + (($scores->[$col+1][EVENT] == GAP_SRC) ? $matrix{gap_extend} : $matrix{gap}); # find the best score among the possibilities my $score; if ($gap_src >= $gap_tgt && $gap_src >= $extend) { $score = [$gap_src,GAP_SRC]; } elsif ($gap_tgt >= $extend) { $score = [$gap_tgt,GAP_TGT]; } else { $score = [$extend,EXTEND]; } # save it for posterity push(@row,$score); ($max_score,$max_row,$max_col) = ($score->[SCORE],$row,$col) if $score->[SCORE] >= $max_score; } print join(' ',($s,map {sprintf("%4d",$_->[SCORE])} @row[1..$#row])),"\n" if DEBUG; $scores = \@row; push(@alignment,[@row[1..$#row]]); } my $alignment = $class->_trace_back($max_row,$max_col,\@alignment); if (DEBUG) { for (my $i=0;$i<@$alignment;$i++) { printf STDERR ("%3d %1s %3d %1s\n", $i,substr($src,$i,1), $alignment->[$i],defined $alignment->[$i] ? substr($tgt,$alignment->[$i],1):''); } } return ($max_score,$alignment); } sub _trace_back { my $self = shift; my ($row,$col,$m) = @_; my @alignment; while ($row >= 0 && $col >= 0) { printf STDERR "row=%d, col=%d score=%d event=%s\n",$row,$col,$m->[$row][$col][SCORE],$EVENTS[$m->[$row][$col][EVENT]] if DEBUG; $alignment[$row] = $col; my $score = $m->[$row][$col]; $row--,$col--,next if $score->[EVENT] == EXTEND; $col--, next if $score->[EVENT] == GAP_TGT; undef($alignment[$row]),$row--,next if $score->[EVENT] == GAP_SRC; } return \@alignment; } 1; __END__