MOBY::CommonSubs - a set of exportable subroutines that are
Index
Code Index:
NAME
MOBY::CommonSubs.pm - a set of exportable subroutines that are
useful in clients and services to deal with the input/output from
MOBY Services
DESCRIPTION
CommonSubs are used to do various manipulations of MOBY service-invocation and
response messages. It is useful both Client and Service side and will ensure
that the message structure is valid as per the latest version of the MOBY API.
It DOES NOT connect to MOBY Central for any of its functions, though it does
contact the ontology server for some of its functions, so it may require a
network connection.
NOTE THAT MOST LEGACY SUBROUTINES IN THIS MODULE HAVE BEEN DEPRECATED
The code is still here for legacy reasons only, but the documentation has
been removed permanently, so if there is a routine that you use that is no
longer documented, consider yourself on dangerous ground. THIS CODE WILL NOT
FUNCTION WITH SERVICES THAT ARE NOT COMPLIANT WITH THE NEW API - FOR EXAMPLE
SERVICES THAT ARE NOT USING NAMED INPUTS AND OUTPUTS!
COMMON USAGE EXAMPLES
Client Side Paradigm
The following is a generalized architecture for all
BioMOBY services showing how to parse response messages
using the subroutines provided in CommonSubs
Services Returning Simples
my $resp = $SI->execute(XMLInputList => \@input_data);
my $responses = serviceResponseParser($resp); # returns MOBY objects
foreach my $queryID(keys %$responses){
$this_invocation = $responses->{$queryID}; # this is the <mobyData> block with this queryID
my $this_output = "";
if (my $data = $this_invocation->{'responseArticleName'}){ # whatever your articleName is...
# $data is a MOBY::Client::Simple|Collection|ParameterArticle
my ($namespace) = @{$data->namespaces};
my $id = $data->id;
my $XML_LibXML = $data->XML_DOM; # get access to the DOM
# assuming that you have an element of type "String"
# with articleName "Description"
my $desc = getNodeContentWithArticle($XML_LibXML, "String", "Description");
###################
# DO SOMETHING TO RESPOSE DATA HERE
###################
}
}
Services Returning Collections
my $resp = $SI->execute(XMLInputList => \@input_data);
my $responses = serviceResponseParser($resp); # returns MOBY objects
foreach my $queryID(keys %$responses){ # $inputs is a hashref of $input{queryid}->{articlename} = input object
my $this_invocation = $responses->{$queryID};
if (my $data = $this_invocation->{'responseArticleName'}){ # $input is a MOBY::Client::Simple|Collection|Parameter object
my $simples = $data->Simples;
foreach my $simple(@$simples){
my ($ns) = @{$simple->namespaces};
my $id = $simple->id;
my $XML_LibXML = $input->XML_DOM; # get access to the DOM
}
}
}
Service-Side Paradigm
The following is a generalized architecture for *all*
BioMOBY services showing how to parse incoming messages
using the subroutines provided in CommonSubs
Services Generating simple outputs
sub _generic_service_name {
my ($caller, $data) = @_;
my $MOBY_RESPONSE;
my $inputs = serviceInputParser($data); # returns MOBY objects
return SOAP::Data->type('base64' => responseHeader("illuminae.com") . responseFooter()) unless (keys %$inputs);
foreach my $queryID(keys %$inputs){
$this_invocation = $inputs->{$queryID}; # this is the <mobyData> block with this queryID
my $this_output = "";
if (my $input = $this_invocation->{incomingRequest}){
my ($namespace) = @{$input->namespaces};
my $id = $input->id;
my $XML_LibXML = $input->XML_DOM; # get access to the DOM
###################
# DO YOUR BUSINESS LOGIC HERE
###################
$this_output = "<moby:Object... rest of the output XML .../>";
}
$MOBY_RESPONSE .= simpleResponse(
$this_output
, "myArticleName" # the article name of that output object
, $queryID); # the queryID of the input that we are responding to
}
return SOAP::Data->type('base64' => (responseHeader("illuminae.com") . $MOBY_RESPONSE . responseFooter));
}
Services generating collection outputs
sub _generic_service_returning_collections {
my($caller, $message) = @_;
my $inputs = serviceInputParser($message);
my $MOBY_RESPONSE = ""; # set empty response
# return empty SOAP envelope if ther is no moby input
return SOAP::Data->type('base64' => responseHeader().responseFooter()) unless (keys %$inputs);
foreach my $queryID(keys %$inputs){ # $inputs is a hashref of $input{queryid}->{articlename} = input object
my $this_invocation = $inputs->{$queryID};
my @outputs;
if (my $input = $this_invocation->{incomingArticleName}){ # $input is a MOBY::Client::Simple|Collection|Parameter object
my $id = $input->id;
my @agis = &_getMyOutputList($id); # this subroutine contains your business logic and returns a list of ids
foreach (@agis){
push @outputs, "<Object namespace='MyNamespace' id='$_'/>";
}
}
$MOBY_RESPONSE .= collectionResponse (\@outputs, "myOutputArticleName", $queryID);
}
return SOAP::Data->type('base64' => (responseHeader("my.authority.org") . $MOBY_RESPONSE . responseFooter));
}
EXAMPLE SERVICE CODE
A COMPLETE EXAMPLE OF AN EASY MOBY SERVICE
This is a service that:
CONSUMES: base Object in the GO namespace
EXECUTES: Retrieval
PRODUCES: GO_Term (in the GO namespace)
# this subroutine is called from your dispatch_with line
# in your SOAP daemon
sub getGoTerm {
use MOBY::CommonSubs qw{:all};
my ($caller, $incoming_message) = @_;
my $MOBY_RESPONSE; # holds the response raw XML
my @validNS = validateNamespaces("GO"); # do this if you intend to be namespace aware!
my $dbh = _connectToGoDatabase(); # connect to some database
return SOAP::Data->type('base64' => responseHeader('my.authURI.com') . responseFooter()) unless $dbh;
my $sth = $dbh->prepare(q{ # prepare your query
select name, term_definition
from term, term_definition
where term.id = term_definition.term_id
and acc=?});
my $inputs= serviceInputParser($incoming_message); # get incoming invocations
# or fail properly with an empty response if there is no input
return SOAP::Data->type('base64' => responseHeader("my.authURI.com") . responseFooter()) unless (keys %$inputs);
foreach my $queryID(keys %$inputs){
my $this_invocation = $inputs->{$queryID}; # this is the <mobyData> block with this queryID
my $invocation_output=""; # prepare a variable to hold the output XML from this invocation
if (my $input = $this_invocation->{GO_id}){ # the articleName of your services input
my ($namespace) = @{$input->namespaces}; # this is returned as a list!
my $id = $input->id;
# optional - if we want to ENSURE that the incoming ID is in the GO namespace
# we can validate it using the validateThisNamespace routine of CommonSubs
# @validNS comes from validateNamespaces routine of CommonSubs (called above)
next unless validateThisNamespace($namespace, @validNS);
# here's our business logic...
$sth->execute($id);
my ($term, $def) = $sth->fetchrow_array;
if ($term){
$invocation_output =
"<moby:GO_Term namespace='GO' id='$id'>
<moby:String namespace='' id='' articleName='Term'>$term</moby:String>
<moby:String namespace='' id='' articleName='Definition'>$def</moby:String>
</moby:GO_Term>";
}
}
# was our service execution successful?
# if so, then build an output message
# if not, build an empty output message
$MOBY_RESPONSE .= simpleResponse( # simpleResponse is exported from CommonSubs
$invocation_output # response for this query
, "A_GoTerm" # the article name of that output object
, $queryID); # the queryID of the input that we are responding to
}
# now return the result
return SOAP::Data->type('base64' => (responseHeader("illuminae.com") . $MOBY_RESPONSE . responseFooter));
}
Simples
For example, the input message:
<mobyData queryID = 'a1a'>
<Simple articleName='name1'>
<Object namespace=blah id=blah/>
</Simple>
<Parameter articleName='cutoff'>
<Value>10</Value>
</Parameter>
</mobyData>
will become:
$inputs->{a1a}->{name1} = $MOBY::Client::Simple, # the <Simple> block
$inputs->{a1a}->{cutoff} = $MOBY::Client::Secondary # <Parameter> block
Collections
With inputs that have collections these are presented as a listref of
Simple article DOM's. So for the following message:
<mobyData queryID = '2b2'>
<Collection articleName='name1'>
<Simple>
<Object namespace=blah id=blah/>
</Simple>
<Simple>
<Object namespace=blah id=blah/>
</Simple>
</Collection>
<Parameter articleName='cutoff'>
<Value>10</Value>
</Parameter>
</mobyData>
will become
$inputs->{2b2}->{name1} = $MOBY::Client::Collection, # the <Collection> Block
$inputs->{2b2}->{cutoff} = $MOBY::Client::Secondary, # the <Parameter> Block
MESSAGE COMPONENT IDENTITY AND VALIDATION
This section describes functionality associated with identifying parts of a message,
and checking that it is valid.
isSimpleArticle, isCollectionArticle, isSecondaryArticle
function: tests XML (text) or an XML DOM node to see if it represents a Simple, Collection, or Secondary article
These routines are unlikely to be useful in a MOBY Object oriented service
but they have been retained for legacy reasons.
usage:
if (isSimpleArticle($node)){do something to it}
or
if (isCollectionArticle($node)){do something to it}
or
if (isSecondaryArticle($node)){do something to it}
input : an XML::LibXML node, an XML::LibXML::Document or straight XML
returns: boolean
validateNamespaces
function: checks the namespace ontology for the namespace lsid
usage: @LSIDs = validateNamespaces(@namespaces)
args: ordered list of either human-readable or lsid presumptive namespaces
returns: ordered list of the LSID's corresponding to those
presumptive namespaces; undef for each namespace that was invalid
validateThisNamespace
function: checks a given namespace against a list of valid namespaces
usage: $valid = validateThisNamespace($ns, @validNS);
args: ordered list of the namespace of interest and the list of valid NS's
returns: boolean
CONSTRUCTING OUTPUT
This section describes how to construct output, in response to an
incoming message. Responses come in three varieties:
- *
Simple - Only simple article(s)
- *
Collection - Only collection(s) of simples
- *
Complex - Any combination of simple and/or collection and/or secondary articles.
simpleResponse
function: wraps a simple article in the appropriate (mobyData) structure.
Works only for simple articles. If you need to mix simples with collections and/or
secondaries use complexReponse instead.
usage: $responseBody = simpleResponse($object, $ArticleName, $queryID);
args: (in order)
$object - (optional) a MOBY Object as raw XML.
$articleName - (optional) an article name for this article.
$queryID - (optional, but strongly recommended) the query ID value for the mobyData block to which you are responding.
notes: As required by the API you must return a response for every
input. If one of the inputs was invalid, you return a valid (empty)
MOBY response by calling simpleResponse(undef, undef, $queryID) with
no arguments.
collectionResponse
function: wraps a set of articles in the appropriate mobyData structure.
Works only for collection articles. If you need to mix collections with simples and/or
secondaries use complexReponse instead.
usage: $responseBody = collectionResponse(\@objects, $articleName, $queryID);
args: (in order)
\@objects - (optional) a listref of MOBY Objects as raw XML.
$articleName - (optional) an artice name for this article.
$queryID - (optional, but strongly recommended) the ID of the query to which you are responding.
notes: as required by the API you must return a response for every
input. If one of the inputs was invalid, you return a valid (empty)
MOBY response by calling collectionResponse(undef, undef, $queryID).
complexResponse
function: wraps articles in the appropriate (mobyData) structure.
Can be used to send any combination of the three BioMOBY article types -
simple, collection and secondary - back to a client.
usage: $responseBody = complexResponse(\@articles, $queryID);
args: (in order)
\@articles - (optional) a listref of arrays. Each element of @articles is
itself a listref of [$articleName, $article], where $article is either
the article's raw XML for simples and secondaries or a reference to an array containing
[$articleName, $simpleXML] elements for a collection of simples.
$queryID - the queryID value for
the mobyData block to which you are responding
notes: as required by the API you must return a response for every
input. If one of the inputs was invalid, you return a valid (empty)
MOBY response by calling complexResponse(undef, $queryID) with no
arguments.
encodeException
function: wraps a Biomoby Exception with all its parameters into the appropiate MobyData structure
usage:
encodeException(
-refElement => 'refers to the queryID of the offending input mobyData',
-refQueryID => 'refers to the articleName of the offending input Simple or Collection'
-severity=>'error'
-exceptionCode=>'An error code '
-exceptionMessage=>'a human readable description for the error code')
args:the different arguments required by the mobyException API
severity can be either error, warning or information
valid error codes are decribed on the biomoby website
notes: returns everything required to use for the responseHeader:
<moby:mobyException moby:refElement='input1' moby:refQueryID='1' moby:severity =''>
<moby:exceptionCode>600</moby:exceptionCode>
<moby:exceptionMessage>Unable to execute the service</moby:exceptionMessage>
</moby:mobyException>
ANCILIARY ELEMENTS
This section contains subroutines that handle processing of optional message elements containing
meta-data. Examples are the ServiceNotes, and CrossReference blocks.
getServiceNotes
function: to get the content of the Service Notes block of the MOBY message
usage: getServiceNotes($message)
args: $message is either the XML::LibXML of the MOBY message, or plain XML
returns: String content of the ServiceNotes block of the MOBY Message
getExceptions
function: to get the content of the Exception part of the Service Notes block of the MOBY message
usage: getExceptions($message)
args: $message is either the XML::LibXML of the MOBY message, or plain XML
returns: an Array of Hashes containing the exception Elemtents and attributes
example: my @ex=getExceptions($XML);
foreach my $exception (@ex) {
print "Reference:",$exception->{refElement},"\n";
print "Query ID:",$exception->{refQueryID},"\n";
print "Severity of message:",$exception->{severity},"\n";
print "Readable message:",$exception->{exceptionMessage},"\n";
print "Exception Code:",$exception->{exceptionCode},"\n";
}
getCrossReferences
function: to get the cross-references for a Simple article. This is primarily a
Client-side function, since service providers should not, usually, be
interpreting Cross-references.
usage: @xrefs = getCrossReferences($XML)
args: $XML is either a SIMPLE article (<Simple>...</Simple>) or an
object (the payload of a Simple article), and may be either raw XML or
an XML::LibXML node.
returns: an array of MOBY::CrossReference objects
example:
my (($colls, $simps) = getResponseArticles($query); # returns DOM nodes
foreach (@{$simps}){
my @xrefs = getCrossReferences($_);
foreach my $xref(@xrefs){
print "Cross-ref type: ",$xref->type,"\n";
print "namespace: ",$xref->namespace,"\n";
print "id: ",$xref->id,"\n";
if ($xref->type eq "Xref"){
print "Cross-ref relationship: ", $xref->xref_type,"\n";
}
}
}
MISCELLANEOUS FUNCTIONS
This section contains routines that didn't quite seem to fit anywhere else.
getNodeContentWithArticle
function: give me a DOM, a TagName, an articleName and I will return you the content
of that node **as a string** (beware if there are additional XML tags in there!)
this is meant for MOBYesque PRIMITIVES - things like:
<String articleName="SequenceString">TAGCTGATCGAGCTGATGCTGA </String>
call _getNodeContentsWithAttribute($DOM_NODE, "String", "SequenceString")
and I will return "TACGATGCTAGCTAGCGATCGG"
Caveat Emptor - I will NOT chop off leading and trailing whitespace or
carriage returns, as these might be meaningful!
usage: @content = getNodeContentWithArticle($XML_DOM, $elementname, $articleName)
args: $XML_DOM is the DOM of a MOBY Object
$elementName is the Tag of an XML element
$articleName is the articleName attribute of the desired XML element
returns: an array of strings representing every line of every match (you probably want to
concatenate these with a "join"... probably...
example:
given
<SomeObject namespace='' id=''>
<String namespace='' id='' articleName="SequenceString">TAGCTGATCGAGCTGATGCTGA </String>
</SomeObject>
my $seq = getNodeContentWithArticle($DOM, "String", "SequenceString");
print "yeah!" if $seq eq "TAGCTGATCGAGCTGATGCTGA";
whichDeepestParentObject
function: select the parent node from nodeList that is closest to the querynode
usage:
($term, $lsid) = whichDeepestParentObject($CENTRAL, $queryTerm, \@termList)
args:
$CENTRAL - your MOBY::Client::Central object
$queryTerm - the object type I am interested in
\@termlist - the list of object types that I know about
returns: an ontology term and LSID as a scalar, or undef if there is
no parent of this node in the nodelist. note that it will only return
the term if you give it term names in the @termList. If you give it
LSID's in the termList, then both the parameters returned will be
LSID's - it doesn't back-translate...)
_rearrange (stolen from BioPerl ;-) )
usage:
$object->_rearrange( array_ref, list_of_arguments)
Purpose : Rearranges named parameters to requested order.
Example:
$self->_rearrange([qw(SEQUENCE ID DESC)],@param);
Where @param = (-sequence = $s, -desc => $d, -id => $i);>
returns: @params - an array of parameters in the requested order.
The above example would return ($s, $i, $d).
Unspecified parameters will return undef. For example, if@param = (-sequence = $s);>
the above _rearrange call would return ($s, undef, undef)
Argument: $order : a reference to an array which describes the desired order of the named parameters.
@param : an array of parameters, either as a list (in which case the function
simply returns the list), or as an associative array with hyphenated
tags (in which case the function sorts the values according to
@{$order} and returns that new array.) The tags can be upper, lower,
or mixed case but they must start with a hyphen (at least the first
one should be hyphenated.)
Source: This function was taken from CGI.pm, written by
Dr. Lincoln Stein, and adapted for use in Bio::Seq by Richard Resnick
and then adapted for use in Bio::Root::Object.pm by Steve Chervitz,
then migrated into Bio::Root::RootI.pm by Ewan Birney.
Comments:
Uppercase tags are the norm, (SAC) This method may not be appropriate
for method calls that are within in an inner loop if efficiency is a
concern.
Parameters can be specified using any of these formats:
@param = (-name=>'me', -color=>'blue');
@param = (-NAME=>'me', -COLOR=>'blue');
@param = (-Name=>'me', -Color=>'blue');
@param = ('me', 'blue');
A leading hyphenated argument is used by this function to indicate
that named parameters are being used. Therefore, the ('me', 'blue')
list will be returned as-is.
Note that Perl will confuse unquoted, hyphenated tags as function
calls if there is a function of the same name in the current
namespace: -name = 'foo'> is interpreted as -&name = 'foo'>
For ultimate safety, put single quotes around the tag: ('-name'='me', '-color' =>'blue');>
This can be a bit cumbersome and I find not as readable as using all
uppercase, which is also fairly safe:(-NAME='me', -COLOR =>'blue');>
Personal note (SAC): I have found all uppercase tags to be more
managable: it involves less single-quoting, the key names stand out
better, and there are no method naming conflicts. The drawbacks are
that it's not as easy to type as lowercase, and lots of uppercase can
be hard to read. Regardless of the style, it greatly helps to line the parameters up
vertically for long/complex lists.
DEPRECATED FUNCTIONS
processResponse
getArticles
getSimpleArticleIDs
getSimpleArticleNamespaceURI
getArticlesAsObjects
getCollectedSimples
getInputArticles
getResponseArticles (a.k.a. extractResponseArticles)
AUTHORS
Mark Wilkinson (markw at illuminae dot com), Pieter Neerincx, Frank Gibbons
BioMOBY Project: http://www.biomoby.org
SEE ALSO
#$Id: CommonSubs.pm,v 1.9 2009/09/01 20:13:20 kawas Exp $
package MOBY::CommonSubs;
use strict;
use warnings;
require Exporter;
use XML::LibXML;
use MOBY::CrossReference;
use MOBY::Client::OntologyServer;
use MOBY::Client::SimpleArticle;
use MOBY::Client::CollectionArticle;
use MOBY::Client::SecondaryArticle;
use MOBY::MobyXMLConstants;
# create the namespace URI
# can be modified by clients if they see fit using
# $MOBY::CommonSubs::MOBY_NS
our $MOBY_NS = 'http://www.biomoby.org/moby';
use constant COLLECTION => 1;
use constant SIMPLE => 2;
use constant SECONDARY => 3;
use constant PARAMETER => 3; # be friendly in case they use this instead
use constant BE_NICE => 1;
use constant BE_STRICT => 0;
our @ISA = qw(Exporter);
our @EXPORT = qw(COLLECTION SIMPLE SECONDARY PARAMETER BE_NICE BE_STRICT);
use vars qw /$VERSION/;
$VERSION = sprintf "%d.%02d", q$Revision: 1.9 $ =~ /: (\d+)\.(\d+)/;
our %EXPORT_TAGS = (
all => [
qw(
getSimpleArticleIDs
getSimpleArticleNamespaceURI
getInputArticles
getInputs
getInputID
getArticles
getCollectedSimples
getNodeContentWithArticle
extractRawContent
validateNamespaces
validateThisNamespace
isSimpleArticle
isCollectionArticle
isSecondaryArticle
extractResponseArticles
getResponseArticles
getCrossReferences
getExceptions
genericServiceInputParser
genericServiceInputParserAsObject
complexServiceInputParser
serviceInputParser
serviceResponseParser
whichDeepestParentObject
getServiceNotes
simpleResponse
collectionResponse
complexResponse
responseHeader
responseFooter
encodeException
COLLECTION
SIMPLE
SECONDARY
PARAMETER
BE_NICE
BE_STRICT
)
]
);
our @EXPORT_OK = (@{$EXPORT_TAGS{'all'}});
sub serviceInputParser {
my ( $message ) = @_; # get the incoming MOBY query XML
my @inputs; # set empty response
my @queries = _getInputs( $message ); # returns XML::LibXML nodes <mobyData>...</mobyData>
my %input_parameters; # $input_parameters{$queryID} = [
foreach my $query ( @queries ) {
my $queryID = _getQID( $query ); # get the queryID attribute of the mobyData
next unless $queryID;
my @input_articles = _getArticlesAsObjects( $query );
# This is done for empty mobyData. It is a strange case
# but it can happen (a service which is a random answer
# generator, for instance)
$input_parameters{$queryID}={};
foreach my $article ( @input_articles ) {
${$input_parameters{$queryID}}{$article->articleName} = $article if $article and $article->articleName ne '';
}
}
return \%input_parameters;
}
*serviceResponseParser = \&serviceInputParser;
*serviceResponseParser = \&serviceInputParser;
sub _getInputs {
my ( $XML ) = @_;
my $moby = _string_to_DOM($XML);
my @queries;
foreach my $querytag qw(mobyData )
{
my $x = $moby->getElementsByLocalName( $querytag ); # get the mobyData block
for ( 1 .. $x->size() ) { # there may be more than one mobyData per message
push @queries, $x->get_node( $_ );
}
}
return @queries; # return them in the order that they were discovered.
}
sub _getArticlesAsObjects {
my ( $moby ) = @_;
$moby = _string_to_DOM($moby);
return undef unless $moby->nodeType == ELEMENT_NODE;
return undef
unless ($moby->localname =~ /^mobyData$/ and ($moby->namespaceURI() ? $moby->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my @articles;
foreach my $child ( $moby->childNodes )
{ # there may be more than one Simple/Collection per input; iterate over them
next unless $child->nodeType == ELEMENT_NODE; # ignore whitespace
next
unless ( $child->localname =~ /^(Simple|Collection|Parameter)$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my $object;
if ( $child->localname=~ /^Simple$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
$object = MOBY::Client::SimpleArticle->new( XML_DOM => $child );
} elsif ( $child->localname=~ /^Collection$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
$object = MOBY::Client::CollectionArticle->new( XML_DOM => $child );
} elsif ( $child->localname =~ /^Parameter$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
$object = MOBY::Client::SecondaryArticle->new( XML_DOM => $child );
}
next unless $object;
push @articles, $object; # take the child elements, which are <Simple/> or <Collection/>
}
return @articles; # return them.
}
sub _getQID {
my ( $XML ) = @_;
my $moby = _string_to_DOM($XML);
return '' unless ( $moby->localname =~ /^mobyData$/ and ($moby->namespaceURI() ? $moby->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my $qid = _moby_getAttribute($moby, 'queryID' );
$qid ||= _moby_getAttribute($moby, 'moby:queryID' );
return defined( $qid ) ? $qid : '';
}
sub isSimpleArticle {
my ( $DOM ) = @_;
eval { $DOM = _string_to_DOM($DOM) };
return 0 if $@;
$DOM = $DOM->getDocumentElement if ( $DOM->isa( "XML::LibXML::Document" ) );
return ($DOM->localname =~ /^Simple$/ and ($DOM->namespaceURI() ? $DOM->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) ? 1 : 0; #Optional 'moby:' namespace prefix
}
sub isCollectionArticle {
my ( $DOM ) = @_;
eval {$DOM = _string_to_DOM($DOM) };
return 0 if $@;
$DOM = $DOM->getDocumentElement if ( $DOM->isa( "XML::LibXML::Document" ) );
return ( $DOM->localname =~ /^Collection$/ and ($DOM->namespaceURI() ? $DOM->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) ? 1 : 0; #Optional 'moby:' prefix
}
sub isSecondaryArticle {
my ( $XML ) = @_;
my $DOM;
eval {$DOM = _string_to_DOM($XML)} ;
return 0 if $@;
$DOM = $DOM->getDocumentElement if ( $DOM->isa( "XML::LibXML::Document" ) );
return ($DOM->localname =~ /^Parameter$/ and ($DOM->namespaceURI() ? $DOM->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) ? 1 : 0; #Optional 'moby:' prefix
}
sub validateNamespaces {
# give me a list of namespaces and I will return the LSID's in order
# I return undef in that list position if the namespace is invalid
my ( @namespaces ) = @_;
my $OS = MOBY::Client::OntologyServer->new;
my @lsids;
foreach ( @namespaces ) {
my ( $s, $m, $LSID ) = $OS->namespaceExists( term => $_ );
push @lsids, $s ? $LSID : undef;
}
return @lsids;
}
sub validateThisNamespace {
my ( $ns, @namespaces ) = @_;
return 1 unless scalar @namespaces; # if you don't give me a list, I assume everything is valid...
@namespaces = @{$namespaces[0]} # if you send me an arrayref I should be kind... DWIM!
if ( ref $namespaces[0] eq 'ARRAY' );
return grep /$ns/, @namespaces;
}
sub simpleResponse {
my ( $data, $articleName, $qID ) = @_; # articleName optional
$qID = _getQueryID( $qID )
if ref( $qID ) =~ /XML\:\:LibXML/; # in case they send the DOM instead of the ID
$data ||= ''; # initialize to avoid uninit value errors
$articleName ||= "";
$qID ||= "";
if ( $articleName || $data) { # Linebreaks in XML make it easier for human debuggers to read!
return "
<moby:mobyData moby:queryID='$qID'>
<moby:Simple moby:articleName='$articleName'>$data</moby:Simple>
</moby:mobyData>
";
} else {
return "
<moby:mobyData moby:queryID='$qID'/>
";
}
}
sub collectionResponse {
my ( $data, $articleName, $qID ) = @_; # articleName optional
my $content = "";
$data ||= [];
$qID ||= '';
# The response should only be completely empty when the input $data is completely empty.
# Testing just the first element is incorrect.
my $not_completely_empty = 0;
foreach (@{$data}) { $not_completely_empty += defined $_ }
unless ( ( ref($data) eq 'ARRAY' ) && $not_completely_empty )
{ # we're expecting an arrayref as input data, and it must not be empty
return "<moby:mobyData moby:queryID='$qID'/>";
}
foreach ( @{$data} ) { # Newlines are for ease of human reading (pretty-printing).
# It's really hard to keep this kind of thing in sync with itself, but for what it's worth, let's leave it in.
if ( $_ ) {
$content .= "<moby:Simple>$_</moby:Simple>\n";
} else {
$content .= "<moby:Simple/>\n";
}
}
if ( $articleName ) {
return "
<moby:mobyData moby:queryID='$qID'>
<moby:Collection moby:articleName='$articleName'>
$content
</moby:Collection>
</moby:mobyData>
";
} else {
return "
<moby:mobyData moby:queryID='$qID'>
<moby:Collection moby:articleName='$articleName'>$content</moby:Collection>
</moby:mobyData>
";
}
}
sub complexResponse {
my ( $data, $qID ) = @_;
#return 'ERROR: expected listref [element1, element2, ...] for data' unless ( ref( $data ) =~ /array/i );
return "<moby:mobyData moby:queryID='$qID'/>\n"
unless ( ref( $data ) eq 'ARRAY' );
$qID = _getQueryID( $qID )
if ref( $qID ) =~ /XML\:\:LibXML/; # in case they send the DOM instead of the ID
my @inputs = @{$data};
my $output = "<moby:mobyData queryID='$qID'>";
foreach ( @inputs ) {
#return 'ERROR: expected listref [articleName, XML] for data element' unless ( ref( $_ ) =~ /array/i );
return "<moby:mobyData moby:queryID='$qID'/>\n"
unless ( ref($_) eq 'ARRAY' );
while ( my ( $articleName, $XML ) = splice( @{$_}, 0, 2 ) ) {
if ( ref($XML) ne 'ARRAY' ) {
$articleName ||= "";
$XML ||= "";
if ( $XML =~ /\<(moby:|)Value\>/ ) {
$output .=
"<moby:Parameter moby:articleName='$articleName'>$XML</moby:Parameter>\n";
} else {
$output .=
"<moby:Simple moby:articleName='$articleName'>\n$XML\n</moby:Simple>\n";
}
# Need to do this for collections also!!!!!!
} else {
my @objs = @{$XML};
$output .= "<moby:Collection moby:articleName='$articleName'>\n";
foreach ( @objs ) {
$output .= "<moby:Simple>$_</moby:Simple>\n";
}
$output .= "</moby:Collection>\n";
}
}
}
$output .= "</moby:mobyData>\n";
return $output;
}
sub responseHeader {
use HTML::Entities ();
my ( $auth, $notes, $exception ) = _rearrange( [qw[AUTHORITY NOTE EXCEPTION]], @_ );
$auth ||= "not_provided";
$notes ||= "";
$exception ||="";
my $xml =
"<?xml version='1.0' encoding='UTF-8'?>"
. "<moby:MOBY xmlns:moby='$MOBY_NS' xmlns='$MOBY_NS'>"
. "<moby:mobyContent moby:authority='$auth'>";
if ($exception) {
$xml .= "<moby:serviceNotes>$exception";
if ( $notes ) {
my $encodednotes = HTML::Entities::encode( $notes );
$xml .= "<moby:Notes>$encodednotes</moby:Notes>";
}
$xml .="</moby:serviceNotes>";
}
elsif ( $notes ) {
my $encodednotes = HTML::Entities::encode( $notes );
$xml .= "<moby:serviceNotes><moby:Notes>$encodednotes</moby:Notes></moby:serviceNotes>";
}
return $xml;
}
sub encodeException{
use HTML::Entities ();
my ( $refElement, $refQueryID, $severity, $code, $message ) = _rearrange( [qw[REFELEMENT REFQUERYID SEVERITY EXCEPTIONCODE EXCEPTIONMESSAGE]], @_ );
$refElement ||= "";
defined($refQueryID) || ($refQueryID= "");
$severity ||= "";
defined($code) || ($code = "");
$message ||= "not provided";
my $xml="<moby:mobyException moby:refElement='$refElement' moby:refQueryID='$refQueryID' moby:severity ='$severity'>".
"<moby:exceptionCode>$code</moby:exceptionCode>".
"<moby:exceptionMessage>".HTML::Entities::encode($message)."</moby:exceptionMessage>".
"</moby:mobyException>";
}
sub responseFooter {
return "</moby:mobyContent></moby:MOBY>";
}
sub getServiceNotes {
my ( $result ) = @_;
return ( "" ) unless $result;
my $moby = _string_to_DOM($result);
my $responses = $moby->findnodes(".//serviceNotes/Notes | .//moby:serviceNotes/moby:Notes");
my $content;
foreach my $n ( 1 .. ( $responses->size() ) ) {
my $resp = $responses->get_node( $n );
foreach my $response_component ( $resp->childNodes ) {
# $content .= $response_component->toString;
$content .= $response_component->nodeValue
if ( $response_component->nodeType == TEXT_NODE );
$content .= $response_component->nodeValue
if ( $response_component->nodeType == CDATA_SECTION_NODE );
}
}
return ( $content );
}
sub getExceptions {
my ( $result ) = @_;
return ( "" ) unless $result;
my $moby = _string_to_DOM($result);
my $responses = $moby->findnodes(".//serviceNotes/mobyException | .//moby:serviceNotes/moby:mobyException");
my @exceptions;
foreach my $n ( 1 .. ( $responses->size() ) ) {
my $except={};
my $resp = $responses->get_node( $n );
$except->{refElement}=$resp->getAttribute("refElement") || $resp->getAttribute("moby:refElement");
$except->{refQueryID}=$resp->getAttribute("refQueryID") || $resp->getAttribute("moby:refQueryID");
$except->{severity}=$resp->getAttribute("severity") || $resp->getAttribute("moby:severity");
foreach my $child ($resp->childNodes) {
if ($child->toString=~/exceptionCode>(.+)<\//) {$except->{exceptionCode}=$1};
if($child->toString=~/exceptionMessage>(.+)<\//) {$except->{exceptionMessage}=$1};
}
push @exceptions,$except;
}
return ( @exceptions );
}
sub getCrossReferences {
my ( $XML ) = @_;
if ($XML =~ /MOBY::Client/){$XML = $XML->XML_DOM}
$XML = _string_to_DOM($XML);
my @xrefs;
my @XREFS;
return () if ( $XML->localname =~ /^Collection$/ and ($XML->namespaceURI() ? $XML->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
if ( $XML->localname =~ /^Simple$/ and ($XML->namespaceURI() ? $XML->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
foreach my $child ( $XML->childNodes ) {
next unless $child->nodeType == ELEMENT_NODE;
$XML = $child;
last; # enforce proper MOBY message structure
}
}
foreach ( $XML->childNodes ) {
next unless (($_->nodeType == ELEMENT_NODE)
|| ($_->localname && $_->localname =~ /^CrossReference$/ and ($_->namespaceURI() ? $_->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) );
foreach my $xref ( $_->childNodes ) {
next unless $xref && ( ($xref->nodeType == ELEMENT_NODE)
|| ($xref->localname && $xref->localname =~ /^(Xref|Object)$/ and ($xref->namespaceURI() ? $xref->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) );
push @xrefs, $xref;
}
}
foreach ( @xrefs ) {
my $x;
if ($_->localname =~ /^Xref$/ and ($_->namespaceURI() ? $_->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) { $x = _makeXrefType( $_ ) }
elsif ($_->localname =~ /^Object$/ and ($_->namespaceURI() ? $_->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) { $x = _makeObjectType( $_ ) }
push @XREFS, $x if $x;
}
return @XREFS;
}
sub getNodeContentWithArticle {
my ( $node, $element, $articleName ) = @_;
my @contents;
return () unless ( (ref( $node ) =~ /XML\:\:LibXML/) && $element);
my $nodes = $node->getElementsByTagName( $element );
unless ( $nodes->get_node( 1 ) ) {
$nodes = $node->getElementsByTagName("moby:$element");
}
$node = $nodes->get_node(1); # this routine should only ever be called if there is only one possible answer, so this is safe
unless ($articleName){ # the request is for root node if no articleName
my $resp;
foreach my $child($node->childNodes){
next unless ($child->nodeType == TEXT_NODE
|| $child->nodeType == CDATA_SECTION_NODE);
$resp .= $child->nodeValue;
}
push @contents, $resp;
return @contents;
}
# if there is an articleName, then get that specific node
for ( 1 .. $nodes->size() ) {
my $child = $nodes->get_node( $_ );
if ( _moby_getAttribute($child, "articleName")
&& ( _moby_getAttribute($child, "articleName") eq $articleName )
)
{
# now we have a valid child, get the content... stringified... regardless of what it is
if ( isSecondaryArticle( $child ) ) {
my $resp;
my $valuenodes = $child->getElementsByTagName('Value');
unless ( $valuenodes->get_node( 1 ) ) {
$valuenodes = $child->getElementsByTagName("moby:Value");
}
for ( 1 .. $valuenodes->size() ) {
my $valuenode = $valuenodes->get_node( $_ );
foreach my $amount ( $valuenode->childNodes ) {
next unless ($amount->nodeType == TEXT_NODE
|| $amount->nodeType == CDATA_SECTION_NODE);
$resp .= $amount->nodeValue;
}
}
push @contents, $resp;
} else {
my $resp;
foreach ( $child->childNodes ) {
next unless ($_->nodeType == TEXT_NODE
|| $_->nodeType == CDATA_SECTION_NODE);
$resp .= $_->nodeValue;
}
push @contents, $resp;
}
}
}
return @contents;
}
sub whichDeepestParentObject {
my ( $CENTRAL, $queryTerm, $termlist ) = @_;
return ( undef, undef )
unless ( $CENTRAL && $queryTerm
&& $termlist && ( ref( $termlist ) eq 'ARRAY' ) );
my %nodeLSIDs;
my $queryLSID = $CENTRAL->ObjLSID( $queryTerm );
foreach ( @$termlist ) { # get list of known LSIDs
my $lsid = $CENTRAL->ObjLSID( $_ );
return ( $_, $lsid )
if ( $lsid eq $queryLSID ); # of course, if we find it in the list, then return it right away!
$nodeLSIDs{$lsid} = $_;
}
return ( undef, undef ) unless keys( %nodeLSIDs );
my $isa =
$CENTRAL->ISA( $queryTerm, 'Object' )
; # set the complete parentage in the cache if it isn't already
return ( undef, undef )
unless $isa; # this should return true or we are in BIIIG trouble!
my @ISAlsids =
$CENTRAL->ISA_CACHE( $queryTerm )
; # returns **LSIDs** in order, so we can shift our way back to root
while ( my $thislsid = shift @ISAlsids ) { # @isas are lsid's
return ( $nodeLSIDs{$thislsid}, $thislsid ) if $nodeLSIDs{$thislsid};
}
return ( undef, undef );
}
#B<function:> Perform the same task as the DOM routine
#getAttribute(Node), but check for both the prefixed and un-prefixed
#attribute name (the prefix in question being, of course,
#"moby:").
#
#B<usage:>
#
# $id = _moby_getAttribute($xml_libxml, "id");
#
#where C<id> is an attribute in the XML block given as C<$xml_libxml>
#
#B<notes:> This function is intended for use internal to this package
#only. It's not exported.
#
#=cut
sub _moby_getAttributeNode {
# Mimics behavior of XML::LibXML method getAttributeNode, but if the unqualified attribute cannot be found,
# we qualify it with "moby:" and try again.
# We do this so often this module, it's worth having a separate subroutine to do this.
my ($xref, $attr) = @_;
my ($package, $filename, $line) = caller;
if ( !(ref($xref) =~ "^XML\:\:LibXML") ) {
warn "_moby_getAttributeNode: Looking for attribute '$attr'"
. "Can't parse non-XML argument '$xref',\n"
. " called from line $line";
return '';
}
if (!defined $attr) {
warn "_moby_getAttributeNode: Non-empty attribute is required"
. "\n called from line $line";
return '';
}
# check for just the attribute by name
return $xref->getAttributeNode($attr)
if $xref->getAttributeNode($attr);
# check for a namespaced attribute by name
return $xref->getAttributeNodeNS($MOBY_NS, $attr)
if $xref->getAttributeNodeNS($MOBY_NS, $attr);
# check for a namespaced attribute with a prefix ... this is probably redundant!
return $xref->getAttributeNode( $xref->lookupNamespacePrefix($MOBY_NS) . ":$attr")
if $xref->lookupNamespacePrefix($MOBY_NS);
# cant find it ...
return '';
}
sub _moby_getAttribute {
# Mimics behavior of XML::LibXML method getAttribute, but if the unqualified attribute cannot be found,
# we qualify it with "moby:" and try again.
# We do this so often this module, it's worth having a separate subroutine to do this.
my ($xref, $attr) = @_;
my ($package, $filename, $line) = caller;
if ( !(ref($xref) =~ "^XML\:\:LibXML")) {
warn "_moby_getAttribute: Looking for attribute '$attr', "
."can't parse non-XML argument '$xref'\n"
. "_moby_getAttribute called from line $line";
return '';
}
if (!defined $attr) {
warn "_moby_getAttribute: Non-empty attribute is required"
. "\n called from line $line";
return '';
}
# check for just the attribute by name
return $xref->getAttribute($attr)
if $xref->getAttribute($attr);
# check for a namespaced attribute by name
return $xref->getAttributeNS($MOBY_NS, $attr)
if $xref->getAttributeNS($MOBY_NS, $attr);
# check for a namespaced attribute with a prefix ... this is probably redundant!
return $xref->getAttribute( $xref->lookupNamespacePrefix($MOBY_NS) . ":$attr")
if $xref->lookupNamespacePrefix($MOBY_NS);
# cant find it ...
return '';
}
sub _makeXrefType {
my ( $xref ) = @_;
my $ns = _moby_getAttributeNode($xref, 'namespace' );
return undef unless $ns;
my $id = _moby_getAttributeNode($xref, 'id' );
return undef unless $id;
my $xr = _moby_getAttributeNode($xref, 'xref_type' );
return undef unless $xr;
my $ec = _moby_getAttributeNode($xref, 'evidence_code' );
return undef unless $ec;
my $au = _moby_getAttributeNode($xref, 'authURI' );
return undef unless $au;
my $sn = _moby_getAttributeNode($xref, 'serviceName' );
return undef unless $sn;
my $XREF = MOBY::CrossReference->new(
type => "xref",
namespace => $ns->getValue,
id => $id->getValue,
authURI => $au->getValue,
serviceName => $sn->getValue,
evidence_code => $ec->getValue,
xref_type => $xr->getValue
);
return $XREF;
}
sub _makeObjectType {
my ( $xref ) = @_;
my $ns = _moby_getAttributeNode($xref, 'namespace' );
return undef unless $ns;
my $id = _moby_getAttributeNode($xref, 'id');
return undef unless $id;
my $XREF = MOBY::CrossReference->new(
type => "object",
namespace => $ns->getValue,
id => $id->getValue,
);
}
sub _rearrange {
# my $dummy = shift;
my $order = shift;
return @_ unless ( substr( $_[0] || '', 0, 1 ) eq '-' );
push @_, undef unless $#_ % 2;
my %param;
while ( @_ ) {
( my $key = shift ) =~ tr/a-z\055/A-Z/d; #deletes all dashes!
$param{$key} = shift;
}
map { $_ = uc( $_ ) } @$order; # for bug #1343, but is there perf hit here?
return @param{@$order};
}
sub _getQueryID {
my ( $query ) = @_;
$query = _string_to_XML($query);
return '' unless ( $query->localname =~ /^mobyData$/ and ($query->namespaceURI() ? $query->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)); #Eddie - unsure
return _moby_getAttribute($query, 'queryID' );
}
sub _string_to_DOM {
# Convert string to DOM.
# If DOM passed in, just return it (i.e., this should be idempotent)
# By Frank Gibbons, Aug. 2005
# Utility subroutine, not for external use (no export), widely used in this package.
my $XML = shift;
my $moby;
return $XML if ( ref($XML) =~ /^XML\:\:LibXML/ );
my $parser = XML::LibXML->new();
my $doc;
eval { $doc = $parser->parse_string( $XML ) };
die("CommonSubs couldn't parse XML '$XML' because\n\t$@") if $@;
return $doc->getDocumentElement();
}
sub processResponse {
print STDERR "the processResponse subroutine in MOBY::CommonSubs is deprecated. Please use serviceResponseParser for API compliance\n";
my ( $result ) = @_;
return ( [], [] ) unless $result;
my $moby;
unless ( ref( $result ) =~ /XML\:\:LibXML/ ) {
my $parser = XML::LibXML->new();
my $doc = $parser->parse_string( $result );
$moby = $doc->getDocumentElement();
} else {
$moby = $result->getDocumentElement();
}
my @objects;
my @collections;
my @Xrefs;
my $success = 0;
foreach my $which ('mobyData', 'moby:mobyData') {
my $responses = $moby->getElementsByTagName( $which );
next unless $responses;
foreach my $n ( 1 .. ( $responses->size() ) ) {
my $resp = $responses->get_node( $n );
foreach my $response_component ( $resp->childNodes ) {
next unless $response_component->nodeType == ELEMENT_NODE;
if ( $response_component->localname =~ /^Simple$/ and ($response_component->namespaceURI() ? $response_component->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1))
{
foreach my $Object ( $response_component->childNodes ) {
next unless $Object->nodeType == ELEMENT_NODE;
$success = 1;
push @objects, $Object;
}
} elsif ( $response_component->localname =~ /^(.*:|)Collection$/ and ($response_component->namespaceURI() ? $response_component->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1))
{
my @objects;
foreach my $simple ( $response_component->childNodes ) {
next unless $simple->nodeType == ELEMENT_NODE;
next unless ( $simple->localname =~ /^Simple$/ and ($simple->namespaceURI() ? $simple->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
foreach my $Object ( $simple->childNodes ) {
next unless $Object->nodeType == ELEMENT_NODE;
$success = 1;
push @objects, $Object;
}
}
push @collections, \@objects
; #I'm not using collections yet, so we just use Simples.
}
}
}
}
return ( \@collections, \@objects );
}
sub genericServiceInputParser {
print STDERR "the genericServiceInputParser function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $message ) = @_; # get the incoming MOBY query XML
my @inputs; # set empty response
my @queries = getInputs( $message ); # returns XML::LibXML nodes <mobyData>...</mobyData>
foreach my $query ( @queries ) {
my $queryID = getInputID( $query ); # get the queryID attribute of the mobyData
my @input_articles =
getArticles( $query )
; # get the Simple/Collection/Secondary articles making up this query <Simple>...</Simple> or <Collection>...</Collection> or <Parameter>...</Parameter>
foreach my $input ( @input_articles ) { # input is a listref
my ( $articleName, $article ) = @{$input}; # get the named article
if ( isCollectionArticle( $article ) ) {
my @simples = getCollectedSimples( $article );
push @inputs, [ COLLECTION, $queryID, \@simples ];
} elsif ( isSimpleArticle( $article ) ) {
push @inputs, [ SIMPLE, $queryID, $article ];
} elsif ( isSecondaryArticle( $article ) )
{ # should never happen in a generic service parser!
push @inputs, [ SECONDARY, $queryID, $article ];
}
}
}
return @inputs;
}
sub complexServiceInputParser {
print STDERR "the complexServiceInputParser function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $message ) = @_; # get the incoming MOBY query XML
my @inputs; # set empty response
my @queries = getInputs( $message ); # returns XML::LibXML nodes <mobyData>...</mobyData>
my %input_parameters; # $input_parameters{$queryID} = [
foreach my $query ( @queries ) {
my $queryID = getInputID( $query ); # get the queryID attribute of the mobyData
my @input_articles =
getArticles( $query )
; # get the Simple/Collection/Secondary articles making up this query <Simple>...</Simple> or <Collection>...</Collection> or <Parameter>...</Parameter>
foreach my $input ( @input_articles ) { # input is a listref
my ( $articleName, $article ) = @{$input}; # get the named article
if ( isCollectionArticle( $article ) ) {
my @simples = getCollectedSimples( $article );
push @{ $input_parameters{$queryID} },
[ COLLECTION, \@simples ];
} elsif ( isSimpleArticle( $article ) ) {
push @{ $input_parameters{$queryID} }, [ SIMPLE, $article ];
} elsif ( isSecondaryArticle( $article ) ) {
push @{ $input_parameters{$queryID} }, [ SECONDARY, $article ];
}
}
}
return \%input_parameters;
}
sub getArticles {
print STDERR "the getArticles function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $moby ) = @_;
$moby = _string_to_DOM($moby);
return undef
unless ( ($moby->nodeType == ELEMENT_NODE)
&& ( $moby->localname =~ /^(queryInput|queryResponse|mobyData)$/ and ($moby->namespaceURI() ? $moby->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) );
my @articles;
foreach my $child ( $moby->childNodes )
{ # there may be more than one Simple/Collection per input; iterate over them
next unless ( ($child->nodeType == ELEMENT_NODE) # ignore whitespace
&& ( $child->localname =~ /^(Simple|Collection|Parameter)$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) );
my $articleName = _moby_getAttribute($child, 'articleName' );
# push the named child DOM elements (which are <Simple> or <Collection>, <Parameter>)
push @articles, [ $articleName, $child ];
}
return @articles; # return them.
}
sub getSimpleArticleIDs {
print STDERR "the getSimpleArticleIDs function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $desired_namespace, $input_nodes ) = @_;
if ( $desired_namespace && !$input_nodes )
{ # if called with ONE argument, then these are the input nodes!
$input_nodes = $desired_namespace;
$desired_namespace = undef;
}
$input_nodes = [$input_nodes]
unless ref( $input_nodes ) eq 'ARRAY'; # be flexible!
return undef unless scalar @{$input_nodes};
my @input_nodes = @{$input_nodes};
my $OS = MOBY::Client::OntologyServer->new;
my ( $s, $m, $namespace_lsid );
if ( $desired_namespace ) {
( $s, $m, $namespace_lsid ) =
$OS->namespaceExists( term => $desired_namespace ); # returns (success, message, lsid)
unless ( $s ) { # bail if not successful
# Printing to STDERR is not very helpful - we should probably return something that can be dealt iwth programatically....
die("MOBY::CommonSubs: the namespace '$desired_namespace' "
. "does not exist in the MOBY ontology, "
. "and does not have a valid LSID");
# return undef;
}
$desired_namespace = $namespace_lsid; # Replace namespace with fully-qualified LSID
}
my @ids;
foreach my $in ( @input_nodes ) {
next unless $in;
#$in = "<Simple><Object namespace='' id=''/></Simple>"
next unless $in->localname =~ /^Simple$/ and ($in->namespaceURI() ? $in->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1); # only allow simples
my @simples = $in->childNodes;
foreach ( @simples ) { # $_ = <Object namespace='' id=''/>
next unless $_->nodeType == ELEMENT_NODE;
if ( $desired_namespace ) {
my $ns = _moby_getAttributeNode($_, 'namespace' ); # get the namespace DOM node
unless ( $ns ) { # if we don't get it at all, then move on to the next input
push @ids, undef; # but push an undef onto teh stack in order
next;
}
$ns = $ns->getValue; # if we have a namespace, then get its value
( $s, $m, $ns ) = $OS->namespaceExists( term => $ns );
# A bad namespace will return 'undef' which makes for a bad comparison (Perl warning).
# Better to check directly for success ($s), THEN check that namespace is the one we wanted.
unless ( $s && $ns eq $desired_namespace )
{ # we are registering as working in a particular namespace, so check this
push @ids, undef; # and push undef onto the stack if it isn't
next;
}
}
# Now do the same thing for ID's
my $id = _moby_getAttributeNode($_, 'id' );
unless ( $id ) {
push @ids, undef;
next;
}
$id = $id->getValue;
unless ( defined $id ) { # it has to have a hope in hell of retrieving something...
push @ids, undef; # otherwise push undef onto the stack if it isn't
next;
}
push @ids, $id;
}
}
return @ids;
}
sub getSimpleArticleNamespaceURI {
print STDERR "the getSimpleArticleNamespaceURI function of MOBY::CommonSubs is deprecated. Please see documentation\n";
# pass me a <SIMPLE> input node and I will give you the lsid of the namespace of that input object
my ( $input_node ) = @_;
return undef unless $input_node;
my $OS = MOBY::Client::OntologyServer->new;
#$input_node = "<Simple><Object namespace='' id=''/></Simple>"
my @simples = $input_node->childNodes;
foreach ( @simples )
{ # $_ = <Object namespace='' id=''/> # should be just one, so I will return at will from this routine
next unless $_->nodeType == ELEMENT_NODE;
my $ns = _moby_getAttributeNode($_, 'namespace' ); # get the namespace DOM node
return undef unless ( $ns ); # if we don't get it at all, then move on to the next input
my ( $s, $m, $lsid ) =
$OS->namespaceExists( term => $ns->getValue ); # if we have a namespace, then get its value
return undef unless $s;
return $lsid;
}
}
sub getInputs {
print STDERR "getInputs is now deprecated. Please update your code to use the serviceInputParser\n";
my ( $XML ) = @_;
my $moby = _string_to_DOM($XML);
my @queries;
foreach my $querytag qw( queryInput moby:queryInput mobyData moby:mobyData )
{
my $x = $moby->getElementsByTagName( $querytag ); # get the mobyData block
for ( 1 .. $x->size() ) { # there may be more than one mobyData per message
push @queries, $x->get_node( $_ );
}
}
return @queries; # return them in the order that they were discovered.
}
sub getInputID {
print STDERR "getInputID method is now deprecated. Please use serviceInputParser or serviceResponseParser\n";
my ( $XML ) = @_;
my $moby = _string_to_DOM($XML);
return '' unless ( $moby->localname =~ /^queryInput|mobyData$/ and ($moby->namespaceURI() ? $moby->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my $qid = _moby_getAttribute($moby, 'queryID' );
$qid ||= _moby_getAttribute($moby, 'moby:queryID' );
return defined( $qid ) ? $qid : '';
}
sub getArticlesAsObjects {
print STDERR "getArticlesAsObjects is now deprecated. Please use the serviceInputParser";
my ( $moby ) = @_;
$moby = _string_to_DOM($moby);
return undef unless $moby->nodeType == ELEMENT_NODE;
return undef
unless ($moby->localname =~ /^(queryInput|queryResponse|mobyData)$/ and ($moby->namespaceURI() ? $moby->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my @articles;
foreach my $child ( $moby->childNodes )
{ # there may be more than one Simple/Collection per input; iterate over them
next unless $child->nodeType == ELEMENT_NODE; # ignore whitespace
next
unless ( $child->localname =~ /^(Simple|Collection|Parameter)$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my $object;
if ( $child->localname =~ /^Simple$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
$object = MOBY::Client::SimpleArticle->new( XML_DOM => $child );
} elsif ( $child->localname =~ /^Collection$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
$object = MOBY::Client::CollectionArticle->new( XML_DOM => $child );
} elsif ( $child->localname =~ /^Parameter$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1)) {
$object = MOBY::Client::SecondaryArticle->new( XML_DOM => $child );
}
next unless $object;
push @articles, $object; # take the child elements, which are <Simple/> or <Collection/>
}
return @articles; # return them.
}
sub getCollectedSimples {
print STDERR "the getCollectedSimples function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $moby ) = @_;
$moby = _string_to_DOM($moby);
return undef unless $moby->nodeType == ELEMENT_NODE;
return undef unless ( $moby->localname =~ /^Collection$/ and ($moby->namespaceURI() ? $moby->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
my @articles;
foreach my $child ( $moby->childNodes )
{ # there may be more than one Simple/Collection per input; iterate over them
next unless $child->nodeType == ELEMENT_NODE; # ignore whitespace
next unless ( $child->localname =~ /^Simple$/ and ($child->namespaceURI() ? $child->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
push @articles, $child; # take the child elements, which are <Simple/> or <Collection/>
}
return @articles; # return them.
}
sub getInputArticles {
print STDERR "the getInputArticles function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $moby ) = @_;
$moby = _string_to_DOM($moby);
my $x;
foreach ( 'queryInput', 'moby:queryInput', 'mobyData', 'moby:mobyData' ) {
$x = $moby->getElementsByTagName( $_ ); # get the mobyData block
last if $x->get_node( 1 );
}
return undef unless $x->get_node( 1 ); # in case there was no match at all
my @queries;
for ( 1 .. $x->size() ) { # there may be more than one mobyData per message
my @this_query;
foreach my $child ( $x->get_node( $_ )->childNodes )
{ # there may be more than one Simple/Collection per input; iterate over them
next unless $child->nodeType == ELEMENT_NODE; # ignore whitespace
push @this_query, $child; # take the child elements, which are <Simple/> or <Collection/>
}
push @queries, \@this_query;
}
return @queries; # return them in the order that they were discovered.
}
sub extractRawContent {
print STDERR "the extractRawContent function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $article ) = @_;
return "" unless ( $article || (ref( $article ) =~ /XML\:\:LibXML/) );
my $response;
foreach ( $article->childNodes ) {
$response .= $_->toString;
}
# print STDERR "RESPONSE = $response\n";
return $response;
}
*getResponseArticles = \&extractResponseArticles;
*getResponseArticles = \&extractResponseArticles;
sub extractResponseArticles {
print STDERR "the extractResponseArticles function of MOBY::CommonSubs is deprecated. Please see documentation\n";
my ( $result ) = @_;
return ( [], [] ) unless $result;
my $moby;
unless ( ref( $result ) =~ /XML\:\:LibXML/ ) {
my $parser = XML::LibXML->new();
my $doc = $parser->parse_string( $result );
$moby = $doc->getDocumentElement();
} else {
$moby = $result->getDocumentElement();
}
my @objects;
my @collections;
my @Xrefs;
my $success = 0;
foreach my $which ( 'moby:queryResponse', 'queryResponse',
'mobyData', 'moby:mobyData' )
{
my $responses = $moby->getElementsByTagName( $which );
next unless $responses;
foreach my $n ( 1 .. ( $responses->size() ) ) {
my $resp = $responses->get_node( $n );
foreach my $response_component ( $resp->childNodes ) {
next unless $response_component->nodeType == ELEMENT_NODE;
if ( $response_component->localname =~ /^Simple$/ and ($response_component->namespaceURI() ? $response_component->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1))
{
foreach my $Object ( $response_component->childNodes ) {
next unless $Object->nodeType == ELEMENT_NODE;
$success = 1;
push @objects, $Object;
}
} elsif ( $response_component->localname =~ /^Collection$/ and ($response_component->namespaceURI() ? $response_component->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1))
{
my @objects;
foreach my $simple ( $response_component->childNodes ) {
next unless $simple->nodeType == ELEMENT_NODE;
next unless ( $simple->localname =~ /^Simple$/ and ($simple->namespaceURI() ? $simple->namespaceURI() =~ m/\Q$MOBY_NS\E/i : 1));
foreach my $Object ( $simple->childNodes ) {
next unless $Object->nodeType == ELEMENT_NODE;
$success = 1;
push @objects, $Object;
}
}
push @collections, \@objects
; #I'm not using collections yet, so we just use Simples.
}
}
}
}
return ( \@collections, \@objects );
}
1;